1The main assignment¶
The Zuker’s algorithm is the state-of-the-art deterministic method to obtain the MFE secondary structure of an RNA strand. However, it is only as good as the parameters used in its implementation. The aim of this exercise is to take my implementation (or your own, if you feel brave enough) and extend it so that it uses at least some of the real nearest-neighbour model parameters. Since we are talking about RNA, the experimental values should be taken from Lu et al. (2006), which can also be found here, in the “RNA (Turner 2004)” section.
In order to be positively evaluated, your code should at least include the proper free-energy contribution of a “perfect” dinucleotide stack, which is defined as two base pairs formed by nucleotides that are complementary, as well as the correct values for hairpins. For instance, “AA/UU” or “AG/UC” are perfect stacks, while “AU/GC” is not.
Remember that NN models given the free energy contribution in terms of and , or and (whence can be computed). This splitting makes it possible to calculate the at any given temperature. This means that, once you have added the “real” stacking contribution, the MFE structure will somehow depend on temperature. Once you think your code works, prepare a plot of vs for an RNA strand, where is the number of base pairs in the MFE structure. You can use the following tRNA sequence: GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA.
2Possible extensions¶
Add the possibility of obtaining the MFE structure of a subsequence of the target RNA strand, . Since with the Zuker’s algorithm the MFE structures of all subsequences are computed during the fill-in phase, you will have to change the traceback function so that it acts only on the subsequence of interest.
Add more parameters from Turner’s model. For instance, you could use the correct values for interior and bulge loops instead of the functions I fitted to the model.
3Additional details¶
You can find all the parameters for hairpins, interior and bulge loops in “Python” format here, but be careful: beyond 30, the energy contribution of the loops is not tabulated. However, the of loops of size can be extrapolated via this relation:
where is the gas constant, is the free energy penalty of a loop of length 30.
For your convenience, here is a Python snippet that shows how to compute the of a “perfect stack”:
T = 273.15 + 37 # fixed temperature of 37° C
# Delta H and Delta S contributions to base steps (from Turner 2004)
dH_dS = {
"AA/UU": (-6.8, -19.0),
"AC/UG": (-11.4, -29.7),
"AG/UC": (-10.5, -27.1),
"AU/UA": (-9.4, -26.8),
"CA/GU": (-10.4, -26.8),
"CC/GG": (-13.4, -32.6),
"CG/GC": (-10.6, -26.4),
"CU/GA": (-10.5, -27.1),
"GA/CU": (-12.4, -32.2),
"GC/CG": (-14.9, -37.1),
"GG/CC": (-13.4, -32.6),
"GU/CA": (-11.4, -29.7),
"UA/AU": (-7.7, -20.6),
"UC/AG": (-12.4, -32.2),
"UG/AC": (-10.4, -26.8),
"UU/AA": (-6.8, -19.0),
# wobble pairs
"AG/UU": (-3.2, -8.4),
"AU/UG": (-8.8, -23.9),
"CG/GU": (-5.6, -13.5),
"CU/GG": (-12.1, -32.2),
"GA/UU": (-12.8, -37.1),
"GC/UG": (-12.6, -32.6),
"GG/CU": (-8.3, -21.9),
"GG/UC": (-12.1, -32.2),
"GG/UU": (-13.5, -41.9),
"GU/CG": (-12.6, -32.6),
"GU/UA": (-8.8, -23.9),
"GU/UG": (-14.6, -51.3),
"UA/GU": (-7.0, -19.3),
"UC/GG": (-8.3, -21.9),
"UG/AU": (-7.0, -19.3),
"UG/GC": (-5.6, -13.5),
"UG/GU": (-9.3, -31.0),
"UU/AG": (-12.8, -37.1),
"UU/GA": (-3.2, -8.4),
"UU/GG": (-13.5, -41.9),
}
def dG(base_step):
return dH_dS[base_step][0] - T * (dH_dS[base_step][1] / 1000.0)
print("The delta G associated to the 'UU/GA' stack is", dG("UU/GA"))- Lu, Z. J., Turner, D. H., & Mathews, D. H. (2006). A set of nearest neighbor parameters for predicting the enthalpy change of RNA secondary structure formation. Nucleic Acids Research, 34(17), 4912–4924. 10.1093/nar/gkl472